Identification of a Novel 7-bp Deletion in the α-Globin Gene Cluster in One Chinese Family.

Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

[Result of carrier screening for spinal muscular atrophy among 3049 reproductive-age individuals from Yunnan region].

OBJECTIVE: To perform carrier screening for spinal muscular atrophy (SMA) among 3049 reproductive-age individuals from Yunnan region and determine the copy number of survival motor neuron (SMN) gene and carrier frequencies. METHODS: Multiplex ligation-dependent probe amplification (MLPA) was used to determine the copy number of exon 7 of SMN1 and SMN2 genes and identify those with a single copy of SMN1 gene. Prenatal diagnosis was performed for couples whom were both found to be SMA carriers. RESULTS: In total 62 SMA carriers were identified among the 3049 subjects, which yielded a carrier frequency of 1 in 49 (2.03%). No statistical difference was found in the carrier frequency between males and females (1.91% vs. 2.30%, P>0.05). Respectively, 1.3% (41/3049) and 0.69% (21/3049) of the carriers were caused by heterozygous deletion and conversion of the SMN1 gene. The average copy number for SMN1 alleles was 1.99. Two couples were found to be both as SMA carriers, for whom the birth of an affected fetus was avoided by prenatal diagnosis. CONCLUSION: No difference was found in the carrier frequency of SMA-related mutations between the two genders in Yunnan region, which was in keeping to an autosomal recessive inheritance pattern. Determination of the carrier frequency for SMA and SMN gene variants may provide a basis for genetic counseling and prenatal diagnosis for the disease.

The analysis of the association between the copy numbers of survival motor neuron gene 2 and neuronal apoptosis inhibitory protein genes and the clinical phenotypes in 40 patients with spinal muscular atrophy: Observational study.

In this article, the correlation between the copy number of survival motor neuron 2 (SMN2) gene, neuronal apoptosis inhibitory protein (NAIP), and the phenotype of spinal muscular atrophy patients were analyzed.Forty patients with spinal muscular atrophy (SMA) were included in the study at the Department of Medical Genetics of the First People's Hospital and the Department of Neurology of the Second People's Hospital in Yunnan Province from January 2012 to September 2018. Multiplex ligation-dependent probe amplification assay was performed to determine the copy numbers of SMN2 and NAIP genes. Statistical analysis was performed to determine the correlation between copy numbers of the SMN2 and NAIP genes and the clinical phenotypes of SMA.Our results show that among the 40 SMA patients, there were 13 type I cases, 16 type II cases and 11 type III cases. A total of 37 patients possessed a homozygous deletion of SMN1 exons 7 and 8, while the other 3 SMA patients possessed a single copy of SMN1 exon 8. There was no correlation between SMA subtypes and the deletion types of SMN1 exon 7 and 8 (P = .611). The percentage of 2, 3, and 4 copies of SMN2 exon 7 was 25.0%, 62.5%, and 12.5%, respectively. The percentage of 0, 1, and 2 copies of NAIP exon 5 was 10%, 57.5%, and 32.5%, respectively. The distributions of SMN2 and NAIP copy numbers among various SMA types were significantly different (all P < .05). Five combined SMN1-SMN2-NAIP genotypes were detected, of which 0-3-1 genotype had the highest proportion than the others, accounting for 42.5%. The copy number of SMN2 and NAIP gene had synergistic effect on SMA phenotype. The combined SMN1-SMN2-NAIP genotypes with fewer copies were associated with earlier onset age, higher mortality, and smaller average age at death in SMA patients.Therefore, we conclude that the copy number variance of SMN2 and NAIP is correlated with the SMA phenotype. Analysis of the copy number structure of the SMN1-SMN2-NAIP gene is helpful for SMA typing, disease prognosis prediction, and genetic counseling.

Differential Expression of Three Cryptosporidium Species-Specific MEDLE Proteins.

Cryptosporidium parvum and Cryptosporidium hominis share highly similar proteomes, with merely ~3% divergence in overall nucleotide sequences. Cryptosporidium-specific MEDLE family is one of the major differences in gene content between the two species. Comparative genomic analysis indicated that MEDLE family may contribute to differences in host range among Cryptosporidium spp. Previous studies have suggested that CpMEDLE-1 encoded by cgd5_4580 and CpMEDLE-2 encoded by cgd5_4590 are potentially involved in the invasion of C. parvum. In this study, we expressed in Escherichia coli, the C. hominis-specific member of the MEDLE protein family, ChMEDLE-1 encoded by chro.50507, and two C. parvum-specific members, CpMEDLE-3 encoded by cgd5_4600 and CpMEDLE-5 encoded by cgd6_5480. Quantitative PCR, immunofluorescence staining and in vitro neutralization assay were conducted to assess their biologic characteristics. The expression of the cgd5_4600 gene was high during 12-48 h of the in vitro culture, while the expression of cgd6_5480 was the highest at 2 h. ChMEDLE-1 and CpMEDLE-3 proteins were mostly located in the anterior and mid-anterior region of sporozoites and merozoites, whereas CpMEDLE-5 was expressed over the entire surface of these invasive stages. Polyclonal antibodies against MEDLE proteins had different neutralization efficiency, reaching approximately 50% for ChMEDLE-1 and 60% for CpMEDLE-3, but only 20% for CpMEDLE-5. The differences in protein and gene expression and neutralizing capacity indicated the MEDLE proteins may have different roles during Cryptosporidium invasion and growth.

[Association of copy number of SMN1 and SMN2 with clinical phenotypes in children with spinal muscular atrophy].

OBJECTIVE: To study the association of copy number of SMN1 and SMN2 with clinical phenotypes in children with spinal muscular atrophy (SMA). METHODS: A total of 45 children with SMA were enrolled. Multiplex ligation-dependent probe amplification was used to measure the gene copy numbers of SMN1 and SMN2. The association of copy number of SMN1 and SMN2 with clinical phenotypes was analyzed. RESULTS: Of the 45 children with SMA, 42 (93%) had a homozygous deletion of SMN1 exons 7 and 8, and 3 (7%) had a deletion of SMN1 exon 7 alone. No association was found between SMA clinical types and the deletion types of SMN1 exons 7 and 8 (P>0.05). There was a significant difference in the distribution of SMN2 gene copy numbers between the children with SMA and the healthy children (P<0.05). The children with SMA usually had two or three copies of SMN2 gene, while the healthy children usually had one or two copies of SMN2 gene. There was a significant difference in the distribution of SMN2 copy numbers among the children with different SMA clinical types (P<0.05). The children with two copies of SMN2 gene had a significantly lower age of onset than those with three or four copies. Most of the children with type I SMA had two or three copies of SMN2 gene. Most of the children with type II SMA had three copies of SMN2 gene. Most of the children with type III SMA had three or four copies of SMN2 gene. Children with a higher copy number of SMN2 gene tended to have an older age of onset and better motor function and clinical outcome, and there was a significant association between SMN2 gene copy number and clinical outcome (P<0.05). CONCLUSIONS: The SMN2 gene can reduce the severity of SMA via the dosage compensation effect. SMN2 copy number is associated with the phenotype of SMA, and therefore, it can be used to predict disease severity.

Characterization of MEDLE-1, a protein in early development of Cryptosporidium parvum.

BACKGROUND: Cryptosporidium spp. are important diarrhea-causing pathogens in humans and animals. Comparative genomic analysis indicated that Cryptosporidium-specific MEDLE family proteins may contribute to host adaptation of Cryptosporidium spp., and a recent study of one member of this family, CpMEDLE-2 encoded by cgd5_4590, has provided evidence supporting this hypothesis. In this study, another member of the protein family, CpMEDLE-1 of Cryptosporidium parvum encoded by cgd5_4580, which is distinct from CpMEDLE-2 and has no signature motif MEDLE, was cloned, expressed and characterized to understand its function. METHODS: CpMEDLE-1 was expressed in Escherichia coli and polyclonal antibodies against the recombinant CpMEDLE-1 protein were prepared in rabbits. Quantitative PCR was used to analyze the expression profile of cgd5_4580 in C. parvum culture. Immunofluorescence staining was used to locate CpMEDLE-1 expression in life-cycle stages, and in vitro neutralization assay with antibodies was adopted to assess the role of the protein in C. parvum invasion. RESULTS: The results indicated that cgd5_4580 had a peak expression at 2 h of C. parvum culture. CpMEDLE-1 was located in the mid-anterior region of sporozoites, probably within the dense granules. The neutralization efficiency of anti-CpMEDLE-1 antibodies was approximately 40%. CONCLUSIONS: The differences in protein and gene expression profiles between CpMEDLE-1 and CpMEDLE-2 suggest that MEDLE proteins have different subcellular locations, are developmentally regulated, could be potentially involved in the transcriptional regulation of the expression of parasite or host proteins and may exert their functions in different stages of the invasion and development process.

[Gene Analysis of Thalassemia in Han and Dai Ethnic Childbearing-aged Population of Chinese Yunnan Province].

OBJECTIVE: To investigate the common mutation spectrum of α- and ß-thalassemia in Yunnan childbearing-aged population. METHODS: The common mutation types of α- or ß-globin genes were detected by multiple Gap-PCR and the PCR-reversed dot blotting, and the unknown mutation types were determined by DNA sequencing in DNA samples of hypochromic microcytic anemia patients and carriers who were confirmed to be positive by serologic screaning, then the mutation types of globin in Yunnan population were analyzed statistically. RESULTS: A total of 40 kinds of mutation types were detected in 685 detected persons, among them the 3 commonest mutation types of α-globin genes were --(SEA)/αα (49.09%), -α(3.7)/αα (36.67%) and α(CS)α/αα (8.79%), the 3 commonest genetypes of ß-globin gene were CD26(GAG>AAG)/N (43.78%), CD41-42(-CTTT)/N (20.1%) and CD17(AAG>TAG)/N (18.9%). There were 348 Han and 212 Dai ethnic persons in 685 cases, but their mutation of globin genes were different between these 2 ethnic groups. The results also showed that the gene mutation types were mostly concentrated in Dai ethnic individuals, since 28 of 38 detected α-ß-thalassemia cases were Dai ethnic individuals. CONCLUSION: The mutation spectrums of α- and ß-globin genes in Yunnan childbearing-aged population are diverse and different from that in other areas of China.

Prevalence of hemoglobin E in Yunnan Province of Southwest China.

OBJECTIVE: The aim of this study was to investigate the prevalence of hemoglobin E (Hb E) as well as the hematological and the phenotypic features of Hb E-related disorders in Yunnan Province of Southwest China. METHODS: A total of 30,908 individuals from more than 30 nationalities who were childbearing population were recruited in the present study. Hematological analysis including complete blood counts and quantification of Hb levels were performed by capillary electrophoresis. The identified carriers were further detected for molecular analysis by multiple gap-polymerase chain reactions (gap-PCR) and the PCR-reverse dot-blot. RESULTS: Hematological results showed that 345 subjects were identified to be Hb E carriers (1.1%). The high incidence of carrying Hb E occurred in Achang (25.0%), Jingpo (23.5%), Dai (16.0%), and Lisu (13.6%). After performing molecular analysis in 201 carriers, 192 cases (95.5%) were heterozygous Hb E and 29 cases (14.4%) of Hb E were con-inherited with α-thal cases. The other ß-globin chain mutation included homozygous Hb E (three cases), ß(+)-thal/Hb E (one case) and ß(0)-thal/Hb E (five cases). Individuals in Dai had the most types of Hb E-related disorders. Severe anemia was observed in cases of ß(+)-thal/Hb E and ß(0)-thal/Hb E. CONCLUSIONS: There is a high prevalence of Hb E among Yunnan populations, especially in ethnic groups. In addition, the spectrums of Hb gene mutations would provide a support for the genetic counseling of Hb E-related disorders among Yunnan populations.